After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rat ADP-sugar Pyrophosphatase/NUDT5 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat NUDT5 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001007733.1
Taille du ADNc:660bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus nudix (nucleoside diphosphate linked moiety X)-type motif 5 with C terminal Flag tag.
Synonyme du gène:Nudt5
Espèces:Rat
Vecteur:pCMV3-C-FLAG
Plasmid:
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Rat ADP-sugar Pyrophosphatase/NUDT5 expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur on other vectors
Rat ADP-sugar Pyrophosphatase/NUDT5 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurRG81109-ACGCHF270
Rat ADP-sugar Pyrophosphatase/NUDT5 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurRG81109-ACRCHF270
Rat ADP-sugar Pyrophosphatase/NUDT5 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurRG81109-ANGCHF270
Rat ADP-sugar Pyrophosphatase/NUDT5 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurRG81109-ANRCHF270
Rat ADP-sugar Pyrophosphatase/NUDT5 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurRG81109-CFCHF230
Rat ADP-sugar Pyrophosphatase/NUDT5 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurRG81109-CHCHF230
Rat ADP-sugar Pyrophosphatase/NUDT5 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurRG81109-CMCHF230
Rat ADP-sugar Pyrophosphatase/NUDT5 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurRG81109-CYCHF230
Rat ADP-sugar Pyrophosphatase/NUDT5 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurRG81109-NFCHF230
Rat ADP-sugar Pyrophosphatase/NUDT5 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurRG81109-NHCHF230
Rat ADP-sugar Pyrophosphatase/NUDT5 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurRG81109-NMCHF230
Rat ADP-sugar Pyrophosphatase/NUDT5 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurRG81109-NYCHF230
Rat ADP-sugar Pyrophosphatase/NUDT5 Gène ADNc clone le vecteur de clonageRG81109-UCHF90
Rat ADP-sugar Pyrophosphatase/NUDT5 expression plasmide de Gène l'ADNc ORF cloneRG81109-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

ADP-sugar Pyrophosphatase, also known as NUDT5, eliminates toxic nucleotide derivatives from the cell and regulate the levels of important signaling nucleotides and their metabolites. NUDT5 functions as a MutT-related protein and catalyzes the hydrolysis of 8-oxoGDP to 8-oxoGMP, thereby preventing misincorporation of 8-oxoGua into RNA. NUDT5 may play significant roles in regulating the G1-S transition in mammalian cells. It can also hydrolyze other nucleotide sugars with low activity.

Références
  • Ishibashi T. et al., 2004, EMBO Rep. 4 (5): 479-8.
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Rush J. et al., 2005, Nat Biotechnol. 23 (1): 94-101.
  • Kamiya H. et al., 2009, DNA Repair. 8 (10): 1250-4.
  • Size / Price
    Catalogue : RG81109-CF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »