NXPH1 cDNA ORF Clone, Rat, N-His tag

Price:
Size:
Number:

NXPH1 cDNA ORF Clone, Rat, N-His tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
816 bp
Description
Full length Clone DNA of Rat neurexophilin 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

NXPH1 Background Information

Neurexophilin-1, or NXPH1 is a secreted glycoprotein, which belongs to the Neurexophilin family. The Neurexophilin family contain at least four genes and resembles a neuropeptide, suggesting a function as an endogenous ligand for alpha-neurexins. The mammalian brains contain four genes for neurexophilins the products of which share a common structure composed of five domains: an N-terminal signal peptide, a variable N-terminal domain, a highly conserved central domain that is N-glycosylated, a short linker region, and a conserved C-terminal domain that is cysteine-rich. Neurexophilin-1 constitutes a secreted cysteine-rich glycoprotein, forms a very tight complex with alpha neurexins, a group of proteins that promote adhesion between dendrites and axons. Neurexophilins 1 and 3 but not 4 (neurexophilin 2 is not expressed in rodents) bind to a single individual LNS domain, the second overall LNS domain in all three alpha-neurexins.
Full Name
neurexophilin 1
References
  • Missler M, et al. (1998) Neurexophilin binding to alpha-neurexins. A single LNS domain functions as an independently folding ligand-binding unit. J Biol Chem. 273(52): 34716-23.
  • Missler M, et al. (1998) Neurexophilins form a conserved family of neuropeptide-like glycoproteins. J Neurosci. 18(10): 3630-8.
  • Petrenko AG, et al. (1996) Structure and evolution of neurexophilin. J Neurosci. 16(14): 4360-9.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait