After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Rat OLR1/LOX1 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat OLR1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_133306.1
Taille du ADNc:1095bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus oxidized low density lipoprotein (lectin-like) receptor 1 with C terminal His tag.
Synonyme du gène:LOX-1, Oldr1, Oldlr1, Olr1
Espèces:Rat
Vecteur:pCMV3-C-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Fond

Oxidized low-density lipoprotein receptor 1 (Ox-LDL receptor 1 or OLR1), also known as lectin-type oxidized LDL receptor 1 (LOX1), is a receptor protein that belongs to the C-type lectin superfamily. LOX1 is a multi-ligand receptor originally identified as the endothelial oxidized LDL receptor. OLR1 / LOX1 was isolated from an aortic endothelial cell, and recently it has been discovered in macrophages and vascular smooth muscle cells in artery vessels. The expression of LOX1 is inducted by inflammatory stimuli and oxidative stimuli. This protein binds, internalizes and degrades oxidized low-density lipoprotein. LOX1 may play an important role in the progression of vulnerable carotid plaque and might regulate vulnerable plaque formation in cooperation with MMPs and TIMP-2. In clinical, LOX1 is thought to be involved in the development of atherosclerotic lesions. 

Références
  • Hinagata J, et al. (2006) Oxidized LDL receptor LOX-1 is involved in neointimal hyperplasia after balloon arterial injury in a rat model. Cardiovasc Res. 69 (1): 263-71.
  • Melan MA, et al. (1994) The LOX1 Gene of Arabidopsis Is Temporally and Spatially Regulated in Germinating Seedlings. Plant Physiol. 105 (1): 385-93.
  • Saito A, et al. (2010) Relationship between lectin-like oxidized low-density lipoprotein receptor 1 expression and preoperative echogenic findings of vulnerable carotid plaque. Acta Neurochir (Wien). 152 (4): 589-95.
  • Size / Price
    Catalogue : RG80268-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »