Commande rapide

Text Size:AAA

Rat OSTC/oligosaccharyltransferase complex subunit expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat OSTC Informations sur les produits clonés de cDNA
Taille du ADNc:450bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus oligosaccharyltransferase complex subunit (non-catalytic) with N terminal Myc tag.
Synonyme du gène:Dc2, RGD1560708
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Rat OSTC/oligosaccharyltransferase complex subunit expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur on other vectors
Rat OSTC/oligosaccharyltransferase complex subunit expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurRG80717-ACGCHF270
Rat OSTC/oligosaccharyltransferase complex subunit expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurRG80717-ACRCHF270
Rat OSTC/oligosaccharyltransferase complex subunit expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurRG80717-CFCHF230
Rat OSTC/oligosaccharyltransferase complex subunit expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurRG80717-CHCHF230
Rat OSTC/oligosaccharyltransferase complex subunit expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurRG80717-CMCHF230
Rat OSTC/oligosaccharyltransferase complex subunit expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurRG80717-CYCHF230
Rat OSTC/oligosaccharyltransferase complex subunit expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurRG80717-NFCHF230
Rat OSTC/oligosaccharyltransferase complex subunit expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurRG80717-NHCHF230
Rat OSTC/oligosaccharyltransferase complex subunit expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurRG80717-NMCHF230
Rat OSTC/oligosaccharyltransferase complex subunit expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurRG80717-NYCHF230
Rat OSTC/oligosaccharyltransferase complex subunit Gène ADNc clone le vecteur de clonageRG80717-UCHF90
Rat OSTC/oligosaccharyltransferase complex subunit expression plasmide de Gène l'ADNc ORF cloneRG80717-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.