After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Rat ERP72 / PDIA4 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat PDIA4 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_053849.1
Taille du ADNc:1932bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus protein disulfide isomerase family A, member 4 with C terminal His tag.
Synonyme du gène:Erp70, Erp72, ERp-72
Espèces:Rat
Vecteur:pCMV3-C-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Fond

ERP72, also known as PDIA4, is an endoplasmic reticulum luminal protein which belongs to the protein disulfide isomerase family. ERP72 is a stress protein and participates in the catalysis of protein-S-S-bond rearrangement. Both of PDIA4 and PDIA3 function as proteases, protein disulfide isomerases, phospholipases or an arrangement of these. ERP72 compose part of a large chaperone multiprotein complex comprising CABP1, DNAJB11, HSP90B1, HSPA5, HYOU, PDIA2, PDIA4, PPIB, SDF2L1, UGT1A1 and very small amounts of ERP29, but not, or at very low levels, CALR nor CANX.

Références
  • Tsai YC, et al. (2012) Functional proteomics establishes the interaction of SIRT7 with chromatin remodeling complexes and expands its role in regulation of RNA polymerase I transcription. Mol Cell Proteomics. 11(5):60-76.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Vinayagam A, et al. (2011) A directed protein interaction network for investigating intracellular signal transduction. Sci Signal. 4(189):rs8.
  • Size / Price
    Catalogue : RG81061-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »