Cyclophilin B cDNA ORF Clone, Rat, untagged

Cat: RG80725-UT

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Cyclophilin B Reagents

CRO Services

Product recommended


All Cyclophilin B Reagents

Cyclophilin B cDNA ORF Clone, Rat, untagged General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
627 bp
Description
Full length Clone DNA of Rat peptidylprolyl isomerase B.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cyclophilin B Background Information

PPIB is identified as a candidate gene for OI-IX.Osteogenesis imperfecta (OI) is an inherited disorder of connective tissue typically caused by defects in either COL1A1 or COL1A2. A number of other genes causative of this disorder have been found, including PPIB, which forms one subunit of the prolyl 3-hydroxylase enzyme complex.Patients with OI caused by PPIB mutation should have appropriate early and regular management of their hearing.
Full Name
peptidylprolyl isomerase B (cyclophilin B)

Cyclophilin B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Cyclophilin B cDNA ORF Clone in Cloning Vector, Rat RG80725-U
Cyclophilin B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80725-ACGLN
Cyclophilin B cDNA ORF Clone, Rat, C-GFPSpark® tag RG80725-ACG
Cyclophilin B cDNA ORF Clone, Rat, C-OFPSpark® tag RG80725-ACR
Cyclophilin B cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80725-CF
Cyclophilin B cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80725-NF
Cyclophilin B cDNA ORF Clone, Rat, C-His tag RG80725-CH
Cyclophilin B cDNA ORF Clone, Rat, N-His tag RG80725-NH
Cyclophilin B cDNA ORF Clone, Rat, C-HA tag RG80725-CY
Cyclophilin B cDNA ORF Clone, Rat, N-HA tag RG80725-NY
Cyclophilin B cDNA ORF Clone, Rat, C-Myc tag RG80725-CM
Cyclophilin B cDNA ORF Clone, Rat, N-Myc tag RG80725-NM
Cyclophilin B qPCR Primer Pairs, Rat RP300689

Cyclophilin B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Cyclophilin B cDNA ORF Clone in Cloning Vector, Mouse MG50294-M
Cyclophilin B cDNA ORF Clone, Mouse, untagged MG50294-UT
Cyclophilin B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50294-ACG
Cyclophilin B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50294-ACGLN
Cyclophilin B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50294-ACR
Cyclophilin B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50294-CF
Cyclophilin B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50294-NF
Cyclophilin B cDNA ORF Clone, Mouse, C-His tag MG50294-CH
Cyclophilin B cDNA ORF Clone, Mouse, N-His tag MG50294-NH
Cyclophilin B cDNA ORF Clone, Mouse, C-HA tag MG50294-CY
Cyclophilin B cDNA ORF Clone, Mouse, N-HA tag MG50294-NY
Cyclophilin B cDNA ORF Clone, Mouse, C-Myc tag MG50294-CM
Cyclophilin B cDNA ORF Clone, Mouse, N-Myc tag MG50294-NM
Cyclophilin B qPCR Primer Pairs, Mouse MP200318

Cyclophilin B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Cyclophilin B cDNA ORF Clone in Cloning Vector, Human HG11004-M
Cyclophilin B cDNA ORF Clone, Human, untagged HG11004-UT
Cyclophilin B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11004-ACGLN
Cyclophilin B cDNA ORF Clone, Human, C-GFPSpark® tag HG11004-ACG
Cyclophilin B cDNA ORF Clone, Human, C-OFPSpark® tag HG11004-ACR
Cyclophilin B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11004-CF
Cyclophilin B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11004-NF
Cyclophilin B cDNA ORF Clone, Human, C-His tag HG11004-CH
Cyclophilin B cDNA ORF Clone, Human, N-His tag HG11004-NH
Cyclophilin B cDNA ORF Clone, Human, C-HA tag HG11004-CY
Cyclophilin B cDNA ORF Clone, Human, N-HA tag HG11004-NY
Cyclophilin B cDNA ORF Clone, Human, C-Myc tag HG11004-CM
Cyclophilin B cDNA ORF Clone, Human, N-Myc tag HG11004-NM
Cyclophilin B qPCR Primer Pairs, Human HP100966
info info
添加购物车成功! 添加购物车失败!