Commande rapide

Rat CD45/PTPRC transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Rat PTPRC Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:NM_001109890.1
    Taille du ADNc:3426bp
    Description du ADNc:Full length Clone DNA of Rattus norvegicus protein tyrosine phosphatase, receptor type, C, transcript variant 1 with C terminal His tag.
    Synonyme du gène:Lca, RT7, CD45, L-CA, T200, Ptprc
    Espèces:Rat
    Vecteur:pCMV3-C-His
    Plasmid:
    Site de restriction:
    Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with PTPRC qPCR primers for gene expression analysis, RP300272 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Rat CD45/PTPRC transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
    Rat CD45/PTPRC transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurRG80296-ACGCHF390
    Rat CD45/PTPRC transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurRG80296-ACRCHF390
    Rat CD45/PTPRC transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurRG80296-ANGCHF390
    Rat CD45/PTPRC transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurRG80296-ANRCHF390
    Rat CD45/PTPRC transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurRG80296-CFCHF350
    Rat CD45/PTPRC transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurRG80296-CHCHF350
    Rat CD45/PTPRC transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurRG80296-CMCHF350
    Rat CD45/PTPRC transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurRG80296-CYCHF350
    Rat CD45/PTPRC transcript variant 1 Gène ADNc clone le vecteur de clonageRG80296-GCHF90
    Rat CD45/PTPRC transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurRG80296-NFCHF350
    Rat CD45/PTPRC transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurRG80296-NHCHF350
    Rat CD45/PTPRC transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurRG80296-NMCHF350
    Rat CD45/PTPRC transcript variant 1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurRG80296-NYCHF350
    Rat CD45/PTPRC transcript variant 1 expression plasmide de Gène l'ADNc ORF cloneRG80296-UTCHF350
     En savoir plus sur les vecteurs d'expression
    Product nameProduct name
    Fond

    The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Protein tyrosine phosphatase, receptor type C (CD45), also known as PTPRC is a member of the protein tyrosine phosphatase (PTP) family which is known for its function to serve as signaling molecules and to regulate a variety of cellular processes such as cell proliferation, differentiation, mitotic cycle and oncogenic transformation. CD45 is found expression specifically in hemotopietic cells. CD45 consists of an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains. It serves as an essential regulator of T-cell and B-cell antigen receptor signaling through either direct interaction with components of the antigen receptor complexs or by activating various Src family kinases required for the antigen receptor signaling and it also can suppress JAK kinases.

    Références
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Irie-Sasaki J, et al. (2001) CD45 is a JAK phosphatase and negatively regulates cytokine receptor signaling. Nature. 409: 349-54.
  • Size / Price
    Catalogue : RG80296-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »