After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rat REG4 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat REG4 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001004096.1
Taille du ADNc:474bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus regenerating islet-derived family, member 4.
Synonyme du gène:Reg4
Espèces:Rat
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Fond

Regenerating islet-derived protein 4, also known as REG-like protein, REG4, GISP and RELP, a member of the regenerating gene family belonging to the calcium (C-type) dependent lectin superfamily, has been found to be involved in malignancy in several different organs including the stomach, colorectum, pancreas and prostate. It is highly expressed in the gastrointestinal tract and markedly up-regulated in colon adenocarcinoma, pancreatic cancer, gastric adenocarcinoma, and inflammatory bowel disease. Expression of the Reg4 in different cell types has been associated with regeneration, cell growth and cell survival, cell adhesion and resistance to apoptosis. REG4 protein overexpression is associated with an unfavorable response to preoperative chemoradiotherapy and may be used as a predictive biomarker clinically. REG4 may play an important role in the development and progression of colorectal cancer, as well as in intestinal morphogenesis and epithelium restitution.

Références
  • Li FY, et al. (2010) RegIV expression showing specificity to gastrointestinal tract and its potential role in diagnosing digestive tract neuroendocrine tumor. J Zhejiang Univ Sci B. 11(4):258-66.
  • Rafa L, et al. (2010) REG4 acts as a mitogenic, motility and pro-invasive factor for colon cancer cells. Int J Oncol. 36(3): 689-98.
  • Hu G, et al. (2010) Purification of a bioactive recombinant human Reg IV expressed in Escherichia coli. Protein Expr Purif. 69(2): 186-90.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »