Commande rapide

Rat REG4 expression plasmide de Gène l'ADNc ORF clone

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Rat REG4 Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:NM_001004096.1
    Taille du ADNc:474bp
    Description du ADNc:Full length Clone DNA of Rattus norvegicus regenerating islet-derived family, member 4.
    Synonyme du gène:Reg4
    Espèces:Rat
    Vecteur:pCMV3-untagged
    Plasmid:
    Site de restriction:
    Séquence du marqueur:
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with REG4 qPCR primers for gene expression analysis, RP300234 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Fond

    Regenerating islet-derived protein 4, also known as REG-like protein, REG4, GISP and RELP, a member of the regenerating gene family belonging to the calcium (C-type) dependent lectin superfamily, has been found to be involved in malignancy in several different organs including the stomach, colorectum, pancreas and prostate. It is highly expressed in the gastrointestinal tract and markedly up-regulated in colon adenocarcinoma, pancreatic cancer, gastric adenocarcinoma, and inflammatory bowel disease. Expression of the Reg4 in different cell types has been associated with regeneration, cell growth and cell survival, cell adhesion and resistance to apoptosis. REG4 protein overexpression is associated with an unfavorable response to preoperative chemoradiotherapy and may be used as a predictive biomarker clinically. REG4 may play an important role in the development and progression of colorectal cancer, as well as in intestinal morphogenesis and epithelium restitution.

    Références
  • Li FY, et al. (2010) RegIV expression showing specificity to gastrointestinal tract and its potential role in diagnosing digestive tract neuroendocrine tumor. J Zhejiang Univ Sci B. 11(4):258-66.
  • Rafa L, et al. (2010) REG4 acts as a mitogenic, motility and pro-invasive factor for colon cancer cells. Int J Oncol. 36(3): 689-98.
  • Hu G, et al. (2010) Purification of a bioactive recombinant human Reg IV expressed in Escherichia coli. Protein Expr Purif. 69(2): 186-90.
  • Size / Price
    Catalogue : RG80249-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »