RHBDD1 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG80856-CM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All RHBDD1 Reagents

CRO Services

Product recommended


All RHBDD1 Reagents

RHBDD1 cDNA ORF Clone, Rat, C-Myc tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
951 bp
Description
Full length Clone DNA of Rat rhomboid domain containing 1 with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RHBDD1 Background Information

Full Name
rhomboid domain containing 1

RHBDD1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RHBDD1 cDNA ORF Clone in Cloning Vector, Rat RG80856-U
RHBDD1 cDNA ORF Clone, Rat, untagged RG80856-UT
RHBDD1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80856-ACG
RHBDD1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80856-ACGLN
RHBDD1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80856-ACR
RHBDD1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80856-CF
RHBDD1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80856-NF
RHBDD1 cDNA ORF Clone, Rat, C-His tag RG80856-CH
RHBDD1 cDNA ORF Clone, Rat, N-His tag RG80856-NH
RHBDD1 cDNA ORF Clone, Rat, C-HA tag RG80856-CY
RHBDD1 cDNA ORF Clone, Rat, N-HA tag RG80856-NY
RHBDD1 cDNA ORF Clone, Rat, N-Myc tag RG80856-NM
RHBDD1 qPCR Primer Pairs, Rat RP300820

RHBDD1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RHBDD1 cDNA ORF Clone in Cloning Vector, Mouse MG5A3021-U
RHBDD1 cDNA ORF Clone, Mouse, untagged MG5A3021-UT
RHBDD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3021-ACG
RHBDD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3021-ACGLN
RHBDD1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A3021-ANG
RHBDD1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A3021-ACR
RHBDD1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A3021-ANR
RHBDD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A3021-CF
RHBDD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A3021-NF
RHBDD1 cDNA ORF Clone, Mouse, C-His tag MG5A3021-CH
RHBDD1 cDNA ORF Clone, Mouse, N-His tag MG5A3021-NH
RHBDD1 cDNA ORF Clone, Mouse, C-HA tag MG5A3021-CY
RHBDD1 cDNA ORF Clone, Mouse, N-HA tag MG5A3021-NY
RHBDD1 cDNA ORF Clone, Mouse, C-Myc tag MG5A3021-CM
RHBDD1 cDNA ORF Clone, Mouse, N-Myc tag MG5A3021-NM

RHBDD1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RHBDD1 cDNA ORF Clone, Human, untagged HG23732-UT
info info
添加购物车成功! 添加购物车失败!