Commande rapide

Text Size:AAA

Rat RRM1 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat RRM1 Informations sur les produits clonés de cDNA
Taille du ADNc:2379bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus ribonucleotide reductase M1 with C terminal His tag.
Synonyme du gène:Rrm1
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name

RRM1 is a subunit of ribonucleoside-diphosphate reductase which is constituted by two subunits. Ribonucleoside-diphosphate reductase is an enzyme essential for the production of deoxyribonucleotides prior to DNA synthesis in S phase of dividing cells. RRM1 is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian, and breast cancer. RRM1 may play a role in malignancies and disease that involve this region.

  • Pitterle DM, et al. (1999) Human gene for the large subunit of ribonucleotide reductase (RRM1): functional analysis of the promoter. Genomics. 27(2):280-5.
  • Parker NJ, et al. (1995) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Gautam A, et al. (2003) RRM1-induced metastasis suppression through PTEN-regulated pathways. Oncogene. 22(14):2135-42.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.