Commande rapide

Text Size:AAA

Rat SIRPA ORF mammalian expression plasmid, C-His tag

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat SIRPA Informations sur les produits clonés de cDNA
Taille du ADNc:1530bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus signal-regulatory protein alpha with C terminal His tag.
Synonyme du gène:Bit, Ptpns1, SHPS-1, Sirpa
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name

Tyrosine-protein phosphatase non-receptor type substrate 1, also known as SHP substrate 1, Inhibitory receptor SHPS-1, Brain Ig-like molecule with tyrosine-based activation motifs, Macrophage fusion receptor, CD172 antigen-like family member A, SIRPA and CD172a, is a single-pass type I membrane protein which contains two Ig-like C1-type (immunoglobulin-like) domains and one Ig-like V-type (immunoglobulin-like) domain. SIRPA is ubiquitously expressed. It is highly expressed in brain and detected at lower levels in heart, placenta, lung, testis, ovary, colon, liver, small intestine, prostate, spleen, kidney, skeletal muscle and pancreas. It is also detected on myeloid cells, but not T-cells. SIRPA is an immunoglobulin-like cell surface receptor for CD47. SIRPA acts as docking protein and induces translocation of PTPN6, PTPN11 and other binding partners from the cytosol to the plasma membrane. SIRPA supports adhesion of cerebellar neurons, neurite outgrowth and glial cell attachment. It may play a key role in intracellular signaling during synaptogenesis and in synaptic function. SIRPA is involved in the negative regulation of receptor tyrosine kinase-coupled cellular responses induced by cell adhesion, growth factors or insulin. It mediates negative regulation of phagocytosis, mast cell activation and dendritic cell activation.

  • Timms JF. et al., 1999, Curr Biol. 9: 927-30.
  • Stofega MR. et al., 2000, J Biol Chem. 275: 28222-9.
  • Liu T. et al., 2005, J Proteome Res. 4: 2070-80.
  • Wolf-Yadlin A. et al., 2007, Proc Natl Acad Sci. 104: 5860-5.
  • Size / Price
    Catalogue : RG80270-CH
    Prix catalogue :   (Save )
    Prix :      [How to order]
    Disponibilité2-3 weeksInstructions d’expédition
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.