CD43 cDNA ORF Clone, Rat, N-HA tag

Price:
Size:
Number:

CD43 cDNA ORF Clone, Rat, N-HA tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1173 bp
Description
Full length Clone DNA of Rat persephin with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD43 Background Information

CD43 is an abundantly expressed molecule on the T-cell surface that shows distinct localization to the migrating T-cell uropod and the distal pole complex (DPC) opposite the immunological synapse via association with the ezrin-radixin-moesin (ERM) family of actin regulatory proteins. CD43 has a 235-amino acid (aa) extracellular domain, a 23-aa transmembrane domain, and a 123-aa cytoplasmic domain, all encoded by a single exon. The intracytoplasmic region of the protein is necessary to transduce signals; it is rich in potentially phosphorylable threonines and serines but lacks tyrosine residues as well as catalytic activity. CD43 engagement on human peripheral blood T cells and monocytes leads to cell activation and proliferation through the generation of second messengers such as diacylglycerol and inositol phosphates, protein kinase C (PKC) activation and Ca2+ mobilization. In addition, CD43 ligation on human T cells induces the association of CD43 with Src family kinases, presumably through the interaction of their Src homology 3 domain with a proline-rich region of the CD43 intracytoplasmic tail. This molecule has been implicated in T cell activation, enhancing T cell response to allogeneic or mitogenic stimulation and CD43-specific signals have been reported to be sufficient to activate T cells in the absence of T cell receptor (TCR) engagement. In summary, CD43 regulates multiple T-cell functions, including T-cell activation, proliferation, apoptosis, and migration.
Full Name
sialophorin
References
  • . Layseca-Espinosa E, et al. (2003) Journal of Leukocyte Biology. 74(6): 1083-93.
  • Cannon JL, et al. (2011) Mol Biol Cell. 22(7):954-63.
  • Pallant A,et al. (1989). Proc Natl Acad Sci. 86 (4): 1328–32.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait