Munc18c / STXBP3 cDNA ORF Clone, Rat, C-Myc tag

Price:
Size:
Number:

Munc18c / STXBP3 cDNA ORF Clone, Rat, C-Myc tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1782 bp
Description
Full length Clone DNA of Rat syntaxin binding protein 3 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Munc18c / STXBP3 Background Information

Syntaxin-binding protein 3, also known as Platelet Sec1 protein, Protein unc-18 homolog 3, Protein unc-18 homolog C, Unc-18C, Unc18-3 and STXBP3, is a cytoplasm protein which belongs to theSTXBP/unc-18/SEC1 family. STXBP3 is expressed in cells that exhibit granule exocytosis, such as neutrophils, mast cells, platelets and endothelial cells. STXBP3, together with STX4 and VAMP2, may play a role in insulin-dependent movement of GLUT4 and in docking / fusion of intracellular GLUT4-containing vesicles with the cell surface in adipocytes. STXBP3 participates in the consolidation and secretion of secondary and tertiary granules. STXBP3 contains one SEC1 domain. Phosphorylation at Ser129 may stimulate granule release. Human STXBP3 shares 9% aa identity with mouse STXBP3. STXBP3 interacts with DOC2B; the interaction is direct, occurs at the cell membrane, excludes interaction with STX4 and regulates glucose-stimulated insulin secretion. Interacts with STX4.
Full Name
syntaxin binding protein 3
References
  • Kidd,M. et al., 2008, Am J Physiol Gastrointest Liver Physiol. 295 (2): G260-72.
  • Macedo,C. et al., 2008, Mol Cell Biochem. 318 (1-2): 63-71.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait