SUCLG1 cDNA ORF Clone, Rat, N-HA tag

Price:
Size:
Number:

SUCLG1 cDNA ORF Clone, Rat, N-HA tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1041 bp
Description
Full length Clone DNA of Rat succinate-CoA ligase, alpha subunit with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SUCLG1 Background Information

Succinyl-coenzyme A ligase (SUCL) is a mitochondrial enzyme that catalyses the reversible conversion of succinyl-coenzyme A to succinate. SUCL consists of an alpha subunit, encoded by SUCLG1, and a beta subunit, encoded by either SUCLA2 or SUCLG2. Molecular studies showed a defective electron transport chain (ETC), mtDNA depletion, and a novel homozygous mutation in the SUCLG1 gene.
Full Name
succinate-CoA ligase, alpha subunit
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait