After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Rat Osteoprotegerin/TNFRSF11B expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat TNFRSF11B Informations sur les produits clonés de cDNA
Taille du ADNc:1206bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus tumor necrosis factor receptor superfamily, member 11b with N terminal Flag tag.
Synonyme du gène:Opg, MGC93568, Tnfrsf11b
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Osteoprotegerin or TNFRSF11B is a member of the TNF-receptor superfamily. This protein is an osteoblast-secreted decoy receptor that functions as a negative regulator of bone resorption. This protein specifically binds to its ligand, osteoprotegerin ligand, both of which are key extracellular regulators of osteoclast development. Studies of the mouse counterpart also suggest that this protein and its ligand play a role in lymph-node organogenesis and vascular calcification. Alternatively spliced transcript variants of this gene have been reported, but their full length nature has not been determined. Osteoprotegerin/TNFRSF11B acts as decoy receptor for RANKL and thereby neutralizes its function in osteoclastogenesis. This protein may inhibit the activation of osteoclasts and promotes osteoclast apoptosis in vitro. Bone homeostasis seems to depend on the local RANKL/OPG ratio. Osteoprotegerin/TNFRSF11B also play a role in preventing arterial calcification, act as decoy receptor for TRAIL and protect against apoptosis. TRAIL binding blocks the inhibition of osteoclastogenesis.

  • Collin-Osdoby P. (2005) Regulation of vascular calcification by osteoclast regulatory factors RANKL and osteoprotegerin. Circ Res. 95 (11): 1046-57.
  • Boyce BF, et al. (2007) Biology of RANK, RANKL, and osteoprotegerin. Arthritis Res. Ther. 9 Suppl 1: S1.
  • Blázquez-Medela AM, et al. ( 2011) Osteoprotegerin and diabetes-associated pathologies. Curr Mol Med. 11 (5): 401-16.
  • Size / Price
    Catalogue : RG80159-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.