After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Rat GITR/TNFRSF18/CD357 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat TNFRSF18 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001024349.1
Taille du ADNc:366bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus tumor necrosis factor receptor superfamily, member 18 with N terminal Flag tag.
Synonyme du gène:Tnfrsf18
Espèces:Rat
Vecteur:pCMV3-SP-N-FLAG
Plasmid:
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Fond

GITR, also known as TNFRSF18(CD357), belongs to the tumor necrosis factor receptor (TNF-R) superfamily. It is the receptor for TNFSF18. GITR plays a key role in dominant immunological self-tolerance maintained by CD25(+)CD4(+) regulatory T cells. GITR may be involved in interactions between activated T-lymphocytes and endothelial cells and in the regulation of T-cell receptor-mediated cell death. GITR and its ligand are important costimulatory molecules in the pathogenesis of autoimmune diseases. It also mediates NF-kappa-B activation via the TRAF2/NIK pathway.

Références
  • Kwon B, et al. (1999) Identification of a novel activation-inducible protein of the tumor necrosis factor receptor superfamily and its ligand. J Biol Chem. 274(10):6056-61.
  • Nocentini G, et al. (1997) A new member of the tumor necrosis factor/nerve growth factor receptor family inhibits T cell receptor-induced apoptosis. Proc Natl Acad Sci. 94(12): 6216-21.
  • Baltz KM, et al. (2007) Cancer immunoediting by GITR (glucocorticoid-induced TNF-related protein) ligand in humans: NK cell/tumor cell interactions. FASEB J. 21(10):2442-54.
  • Size / Price
    Catalogue : RG80192-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »