Commande rapide

Rat TNFRSF19/TROY expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat TNFRSF19 Informations sur les produits clonés de cDNA
Taille du ADNc:1251bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus tumor necrosis factor receptor superfamily, member 19 with N terminal Flag tag.
Synonyme du gène:RGD1564996, Tnfrsf19
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
( We provide with TNFRSF19 qPCR primers for gene expression analysis, RP300160 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Tumor necrosis factor receptor superfamily, member 19 (TNFRSF19), also known as TAJ-alpha or TROY, is a member of the TNF-receptor superfamily. TNFRSF19/TROY expression is detected in the pulmonary epithelium and the ductal epithelium of the prostate and parotid glands. TNFRSF19/TROY expression is detected in some adenocarcinoma cell lines that arise from this tissue. It has been shown to interact with TRAF family members, and to activate JNK signaling pathway when overexpressed in cells. TNFRSF19/TROY is capable of inducing apoptosis by a caspase-independent mechanism, and it is thought to play an essential role in embryonic development. TNFRSF19/TROY was negatively regulated by adipogenic transcription factor CCAAT/enhancer-binding proteins (C/EBP). TNFRSF19 signals activation of the Jnk pathway and induces cell death. Overexpression of TNFRSF19 also signals NFB activation, comparable and similar to that by p75NGFR. TNFRSF19/TROY is capable of activating key signaling pathways of the TNF receptor family, and its predominant expression patterns suggest that it plays a role in the growth and regulation of epithelial tissues.

  • Hu S, et al. (1999) Characterization of TNFRSF19, a novel member of the tumor necrosis factor receptor superfamily. Genomics. 62(1): 103-7.
  • Qiu W, et al. (2010) Tumor necrosis factor receptor superfamily member 19 (TNFRSF19) regulates differentiation fate of human mesenchymal (stromal) stem cells through canonical Wnt signaling and C/EBP. J Biol Chem. 285(19): 14438-49.
  • Hisaoka T, et al. (2006) Characterization of TROY/TNFRSF19/TAJ-expressing cells in the adult mouse forebrain. Brain Res. 1110(1): 81-94.
  • Size / Price
    Catalogue : RG80167-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Ajouter au panierBulk Discount Requiry
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.