Commande rapide

Humain SIVA1 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human SIVA1 Informations sur les produits clonés de cDNA
Taille du ADNc:
Description du ADNc:
Synonyme du gène:
Site de restriction:
Séquence du marqueur:
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Human SIVA1 Gene Plasmid Map
Human SIVA1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Contact Us
  • Human SIVA1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Articles consultés récemment
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.