After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain SPEG/APEG-1 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human SPEG Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001173476.1
Taille du ADNc:342bp
Description du ADNc:Full length Clone DNA of Homo sapiens SPEG complex locus.
Synonyme du gène:BPEG, APEG1, APEG-1, SPEGbeta, SPEGalpha
Espèces:Human
Vecteur:pCMV/hygro
Plasmid:pCMV-SPEG
Site de restriction:KpnI + XhoI (5.5kb + 0.34kb)
Séquence du marqueur:
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human SPEG Gene Plasmid Map
Human SPEG Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Humain SPEG/APEG-1 expression plasmide de Gène l'ADNc ORF clone on other vectors
Product nameProduct name
Fond

Striated muscle preferentially expressed protein kinase, also known as aortic preferentially expressed protein 1, APEG-1, SPEG and KIAA1297, is a protein which belongs to the protein kinase superfamily and CAMK Ser/Thr protein kinase family. SPEG / APEG-1 contains two fibronectin type-III domains, nine Ig-like (immunoglobulin-like) domains, two protein kinase domains. Isoform 1 of SPEG is preferentially expressed in striated muscle. Non-kinase form such as isoform 3 of SPEG is predominantly expressed in the aorta. Isoform 3 of SPEG appears to be expressed only in highly differentiated ASMC in normal vessel walls and down-regulated in dedifferentiated ASMC. Isoform 3 of SPEG may have a role in regulating the growth and differentiation of arterial smooth muscle cells. Isoform 3 of SPEG is quickly down-regulated in response to vascular injury, when ASMC cells change from a quiescent to a proliferative phenotype.

Références
  • Hsieh C.-M., et al., 1996, J. Biol. Chem. 271:17354-17359.
  • Manjasetty B.A., et al., 2005, BMC Struct. Biol. 5:21-21.
  • Zhou,Y. et al., 2007, Anal Chem. 79 (15): 5826-37.
  • Greenman C., et al., 2007, Nature. 446:153-158.
  • Size / Price
    Catalogue : HG12472-G-N
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
    • Human SPEG Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »