After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain SSU72 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human SSU72 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:
Taille du ADNc:
Description du ADNc:
Synonyme du gène:
Espèces:Human
Vecteur:
Site de restriction:
Séquence du marqueur:
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:
Stockage:
Human SSU72 Gene Plasmid Map
Human SSU72 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Contact Us
Images
  • Human SSU72 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »