EHD2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

EHD2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1632 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens EH-domain containing 2.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

EHD2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Alternative Names

PAST2 cDNA ORF Clone, Human

EHD2 Background Information

The four mammalian C-terminal Eps15 homology domain-containing proteins (EHD1-EHD4) play pivotal roles in endocytic membrane trafficking. C-Terminal EH domain-containing protein 2 (EHD2) of the EHD family is associated with plasma membrane. which initial description as a plasma membrane-associated protein. EHD2 is important for protein interactions during vesicular trafficking. EHD2 was linked with neuronal apoptosis and microglial phagocytosis. Eps15 homology domain-containing 2 (EHD2) is a tumor suppressor gene, overexpressed in several solid tumors, including ovarian cancer and esophageal squamous cell carcinoma, EHD2 may serve as a prognostic marker in breast cancer.
Full Name
EH-domain containing 2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait