ANGPTL2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

1/1

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

ANGPTL2 cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1482 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human angiopoietin-like 2 with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
HindIII + XhoI (5.4kb + 1.53kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ANGPTL2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ANGPTL2 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Validated Images

ANGPTL2 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

ARP2 cDNA ORF Clone, Human; HARP cDNA ORF Clone, Human

ANGPTL2 Background Information

The angiopoietin-like protein (ANGPTL) family is homologous to angiopoietins but does not bind to the Tie2 receptor. The function of ANGPTLs has been elucidated largely in the context of angiogenesis and lipid metabolism. Morinaga et al. demonstrated that genetic depletion of Angptl2 confers amelioration of the mouse kidney fibrosis induced by a unilateral ureteral obstruction, implicating that ANGPTL2, predominantly in the renal tubular compartments, activates the transforming growth factor-β signaling and vice versa through miR-221. Angiopoietin-like protein 2 (ANGPTL2) maintains tissue homeostasis by inducing inflammation and angiogenesis. It is produced in infiltrating immune cells or resident cells, such as adipocytes, vascular endothelial cells, and tumor cells. The classic sequential cascade of P. gingivalis LPS → inflammatory cytokine induction is well established. However, in the current study, we reveal a novel cascade comprising sequential P. gingivalis LPS → ANGPTL2 → integrin α5β1 → inflammatory cytokine induction, which might be responsible for inducing potent periodontal disorganization activity in gingival epithelial cells. Via this pathway, ANGPTL2 functions in the pathogenesis of periodontitis and contributes to prolonging chronic inflammation in patients with systemic disease. That MAC-3-positive immune cells, including infiltrating bone marrow-derived macrophages and activated microglia, express abundant angiopoietin-like protein (ANGPTL) 2 in ischemic mouse brain in a transient middle cerebral artery occlusion (MCAO) model. Both neurological deficits and infarct volume decreased in transient MCAO model mice established in Angptl2 knockout (KO) relative to wild-type mice. Acute brain inflammation after ischemia-reperfusion, as estimated by expression levels of pro-inflammatory cytokines such as interleukin (IL)-1β and tumor necrosis factor alpha (TNF)-α, was significantly suppressed in Angptl2 KO compared to control mice.
Full Name
angiopoietin-like 2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait