ARP2/3 cDNA ORF Clone, Human, C-DDK (Flag®) tag

1/1

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

ARP2/3 cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1119 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human actin related protein 2/3 complex, subunit 1B, 41kDa with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
KpnI + XhoI (5.4kb + 1.17kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ARP2/3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ARP2/3 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Validated Images

ARP2/3 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

ARC41 cDNA ORF Clone, Human; p40-ARC cDNA ORF Clone, Human; p41-ARC cDNA ORF Clone, Human

ARP2/3 Background Information

Arpc1b, was earlier found to be down-regulated in an estrogen-induced rat model of spermiation failure. Also, Arpc1b was found to be estrogen responsive through estrogen receptor beta in seminiferous tubule culture. Here, knockdown of Arpc1b by siRNA in adult rat testis led to defects in spermiation caused by failure in TBC formation. Knockdown also compromised BTB integrity and caused polarity defects of mature spermatids. Apart from these effects pertaining to Sertoli cells, Arpc1b reduction perturbed ability of germ cells to enter G2/M phase thus hindering cell division. That Arpc1b, an estrogen responsive gene, is a regulator of spermiation, mature spermatid polarity, BTB integrity and cell division during adult spermatogenesis. Low-expression of ARPC1B is significantly associated with LNM and advanced tumor staging whereas high expression of Cav-1 can be a prognostic indicator for poor prognosis in OSCC patients. Arp2/3 complexes containing ARPC1B and ARPC5L are significantly better at promoting actin assembly than those with ARPC1A and ARPC5, both in cells and in vitro. Branched actin networks induced by complexes containing ARPC1B or ARPC5L are also disassembled ∼2-fold slower than those formed by their counterparts.
Full Name
actin related protein 2/3 complex, subunit 1B, 41kDa
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait