CD24 cDNA ORF Clone, Human, C-Myc tag

1/1

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

CD24 cDNA ORF Clone, Human, C-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
243 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human CD24 molecule with Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV2-Myc
Restriction Sites
KpnI + XhoI (5.4kb + 0.29kb)
Tag Sequence
Myc Tag Sequence: CAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD24 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD24 cDNA ORF Clone, Human, C-Myc tag: Validated Images

CD24 cDNA ORF Clone, Human, C-Myc tag: Alternative Names

CD24A cDNA ORF Clone, Human; FLJ22950 cDNA ORF Clone, Human; FLJ43543 cDNA ORF Clone, Human; MGC75043 cDNA ORF Clone, Human

CD24 Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 32 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 24, also known as signal transducer CD24 or heat stable antigen CD24 (HSA), is a mucin-type glycosylphosphatidylinositol-linked glycoprotein expressed on the surface of B-cells, differentiating neuroblasts and many tumors. It is involved in molecular adhesion and metastatic tumor spread and serve as a normal receptor for P-selectin. The CD24 / P-selectin pathway could be important in dissimenating of tumor cells by facilitating the interaction with platelet and endothelial cells. It has also been considered as a tumor marker. High rate of CD24 expressions have been found in epithelial ovarian cancer, breast cancer, non-small cell lung cancer, prostate cancer and pancreatic cancer.
Full Name
CD24 molecule
References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Kristiansen G, et al. (2003) Tumour biological aspects of CD24, a mucin-like adhesion molecule. Journal of molecular histology. 35 (3): 255-62.

CD24 cDNA ORF Clone, Mouse, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait