CD9 cDNA ORF Clone, Human, C-DDK (Flag®) tag

1/1

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

CD9 cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
687 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human CD9 molecule with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
KpnI + XhoI (5.4kb + 0.74kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD9 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD9 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Validated Images

CD9 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

BTCC-1 cDNA ORF Clone, Human; DRAP-27 cDNA ORF Clone, Human; MIC3 cDNA ORF Clone, Human; MRP-1 cDNA ORF Clone, Human; TSPAN-29 cDNA ORF Clone, Human; TSPAN29 cDNA ORF Clone, Human

CD9 Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 32 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD9 is a member of the transmembrane 4 superfamily, which is also known as the tetraspanin family. CD9 is a cell surface glycoprotein with 4 hydrophobic domains that is described to complex with integrins and other transmembrane 4 superfamily members. It is found expressed on the surface of the exosomes. The protein takes part in cellular signal transduction events and thus play a role in the regulation of cell development and activation, growth and motility. Besides, CD9 seems to be a key role in the egg-sperm fusion during the mammalian fertilization processes. CD9 is found on the membrane of the oocytes and also appears to intervene in maintaining the normal shape of oocyte microvilli.
Full Name
CD9 molecule
References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12
  • Franois Le Naour, et al. (2000) Severely Reduced Female Fertility in CD9-Deficient Mice. Science. 287(5451): 319-21.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait