CHST15 cDNA ORF Clone, Human, untagged

1/1

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

CHST15 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1686 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15 DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XhoI
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CHST15 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CHST15 cDNA ORF Clone, Human, untagged: Validated Images

CHST15 cDNA ORF Clone, Human, untagged: Alternative Names

BRAG cDNA ORF Clone, Human; GALNAC4S-6ST cDNA ORF Clone, Human

CHST15 Background Information

Carbohydrate sulfotransferase 15, also known as N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase, GalNAc4S-6ST, B-cell RAG-associated gene protein, CHST15 and BRAG, is a single-pass type II membrane protein which belongs to thesulfotransferase 1 family. CHST15 / BRAG is expressed in B-cell-enriched tissues but not in fetal or adult thymus. It is expressed in fetal and adult spleen, lymph node, tonsil, bone marrow and peripheral leukocytes. It is not expressed in T-cells. In pro-B, pre-B, and mature B-cell lines, it colocalizes with RAG1. CHST15 / BRAG is a sulfotransferase that transfers sulfate from 3'-phosphoadenosine 5'-phosphosulfate (PAPS) to the C-6 hydroxyl group of the GalNAc 4-sulfate residue of chondroitin sulfate A and forms chondroitin sulfate E containing GlcA-GalNAc(4,6-SO4) repeating units. It also transfers sulfate to a unique non-reducing terminal sequence, GalNAc(4SO4)-GlcA(2SO4)-GalNAc(6SO4), to yield a highly sulfated structure similar to the structure found in thrombomodulin chondroitin sulfate. CHST15 / BRAG may also act as a B-cell receptor involved in BCR ligation-mediated early activation that mediate regulatory signals key to B-cell development and / or regulation of B-cell-specific RAG expression.
Full Name
carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15
References
  • Verkoczy L.K., et al.,(1998), hBRAG, a novel B cell lineage cDNA encoding a type II transmembrane glycoprotein potentially involved in the regulation of recombination activating gene 1 (RAG1). Eur. J. Immunol. 28:2839-2853.
  • Yuki M., et al., (2000), Structure, expression and mutational analysis of the hBRAG gene on 10q in the frequently deleted region in human endometrial cancer.Oncol. Rep. 7:1339-1342.
  • Ohtake S., et al.,(2001), Human N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase cDNA is related to human B cell recombination activating gene-associated gene.J. Biol. Chem. 276:43894-43900.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait