After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Humain Coagulation Factor X/F10 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Human F10 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_000504.3
Taille du ADNc:1461bp
Description du ADNc:Full length Clone DNA of Homo sapiens coagulation factor X.
Synonyme du gène:F10, FX, FXA
Espèces:Human
Vecteur:pCMV/hygro
Plasmid:pCMV-F10
Site de restriction:HindIII + XbaI (5.5kb + 1.46kb)
Séquence du marqueur:
Description de la séquence:Identical with the Gene Bank Ref. ID sequence except for the point mutation: 792 C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Human F10 Gene Plasmid Map
Human F10 / FX Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Humain Coagulation Factor X/F10 expression plasmide de Gène l'ADNc ORF clone on other vectors
Humain Coagulation Factor X/F10 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurHG11076-ACGCHF270
Humain Coagulation Factor X/F10 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurHG11076-ACRCHF270
Humain Coagulation Factor X/F10 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurHG11076-ANGCHF270
Humain Coagulation Factor X/F10 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurHG11076-ANRCHF270
Humain Coagulation Factor X/F10 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurHG11076-CFCHF230
Humain Coagulation Factor X/F10 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurHG11076-CHCHF230
Humain Coagulation Factor X/F10 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurHG11076-CMCHF230
Humain Coagulation Factor X/F10 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurHG11076-CYCHF230
Humain Coagulation Factor X/F10 Gène ADNc clone le vecteur de clonageHG11076-GCHF90
Humain Coagulation Factor X/F10 expression plasmide de Gène l'ADNc ORF cloneHG11076-G-NCHF230
Humain Coagulation Factor X/F10 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurHG11076-NFCHF230
Humain Coagulation Factor X/F10 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurHG11076-NHCHF230
Humain Coagulation Factor X/F10 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurHG11076-NMCHF230
Humain Coagulation Factor X/F10 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurHG11076-NYCHF230
Humain Coagulation Factor X/F10 expression plasmide de Gène l'ADNc ORF cloneHG11076-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Fond

Coagulation factor X, also known as FX, F10, Eponym Stuart-Prower factor, and thrombokinase, is an enzyme of the coagulation cascade. It is one of the vitamin K-dependent serine proteases, and plays a crucial role in the coagulation cascade and blood clotting, as the first enzyme in the common pathway of thrombus formation. Factor X deficiency is one of the rarest of the inherited coagulation disorders. FX deficiency among the most severe of the rare coagulation defects, typically including hemarthroses, hematomas, and umbilical cord, gastrointestinal, and central nervous system bleeding. Factor X is synthesized in the liver as a mature heterodimer formed from a single-chain precursor, and vitamin K is essential for its synthesis. Factor X is activated into factor Xa (FXa) by both factor IX (with its cofactor, factor VIII in a complex known as intrinsic Xase) and factor VII (with its cofactor, tissue factor in a complex known as extrinsic Xase) through cleaving the activation propeptide. As the first member of the final common pathway or thrombin pathway, FXa converts prothrombin to thrombin in the presence of factor Va, Ca2+, and phospholipid during blood clotting and cleaves prothrombin in two places (an arg-thr and then an arg-ile bond). This process is optimized when factor Xa is complexed with activated cofactor V in the prothrombinase complex. Inborn deficiency of factor X is very uncommon, and may present with epistaxis (nose bleeds), hemarthrosis (bleeding into joints) and gastrointestinal blood loss. Apart from congenital deficiency, low factor X levels may occur occasionally in a number of disease states. Furhermore, factor X deficiency may be seen in amyloidosis, where factor X is adsorbed to the amyloid fibrils in the vasculature.

Références
  • Rosen ED. (2002) Gene targeting in hemostasis. Factor X. Front Biosci. 7: d1915-25.
  • Uprichard J, et al. (2002) Factor X deficiency. Blood Rev. 16(2): 97-110.
  • Borensztajn K, et al. (2008) Factor Xa: at the crossroads between coagulation and signaling in physiology and disease. Trends Mol Med. 14(10): 429-40.
  • Menegatti M, et al. (2009) Factor X deficiency. Semin Thromb Hemost. 35(4): 407-15.
  • Size / Price
    Catalogue : HG11076-G-N
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    DisponibilitéIn Stock
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
    • Human F10 / FX Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »