GPR56 cDNA ORF Clone, Human, untagged

1/1

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

GPR56 cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2082 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutation 996T/C not causing the amino acid variation.
Description
Full length Clone DNA of Human G protein-coupled receptor 56 DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XbaI
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GPR56 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GPR56 cDNA ORF Clone, Human, untagged: Validated Images

GPR56 cDNA ORF Clone, Human, untagged: Alternative Names

BFPP cDNA ORF Clone, Human; DKFZp781L1398 cDNA ORF Clone, Human; TM7LN4 cDNA ORF Clone, Human; TM7XN1 cDNA ORF Clone, Human; UNQ540/PRO1083 cDNA ORF Clone, Human

GPR56 Background Information

GPR56 is a member of an adhesion G protein-coupled receptor family with a very long N-terminal stalk and seven transmembrane domains. GPR56 may be a target for the treatment of type 2 diabetes. GPR56 inhibits melanoma metastatic growth by impeding the expansion of micrometastases to macrometastases. GPR56 loss of function promotes mesenchymal differentiation and radioresistance of glioma initiating cells both in vitro and in vivo.
Full Name
adhesion G protein-coupled receptor G1
References
  • Liu M., et al., 1999, Genomics 55: 296-305.
  • Huang,Y. et al., 2008, Mol Cell Biochem. 308 (1-2):133-9.
  • Li,S. et al., 2008, J Neurosci 28 (22):5817-26.
  • Jin,Z. et al., 2009, Prog Mol Biol Transl Sci. 89 :1-13.
  • Xu,L. et al., 2010, Clin Exp Metastasis. 27 (4):241-9.

GPR56 cDNA ORF Clone, Human, Related Products

GPR56 cDNA ORF Clone, Mouse, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait