HSD11B1 cDNA ORF Clone, Human, N-HA tag

Price:
Size:
Number:

HSD11B1 cDNA ORF Clone, Human, N-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
879 bp
Description
Full length Clone DNA of Human hydroxysteroid (11-beta) dehydrogenase 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

HSD11B1 cDNA ORF Clone, Human, N-HA tag: Alternative Names

11-beta-HSD1 cDNA ORF Clone, Human; 11-DH cDNA ORF Clone, Human; CORTRD2 cDNA ORF Clone, Human; HDL cDNA ORF Clone, Human; HSD11 cDNA ORF Clone, Human; HSD11B cDNA ORF Clone, Human; HSD11L cDNA ORF Clone, Human; SDR26C1 cDNA ORF Clone, Human
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait