Commande rapide

Text Size:AAA

pCMV3-C-Myc Negative Control Vector (C-terminal Myc-tagged)

    Fiche techniqueCommentairesProduits apparentésProtocoles
    • Negative control for the pCMV3-C-Myc clone.
    • Vector sequence is the same as pCMV3-C-Myc, but multiple cloning sites are removed.
    • Designed for mammalian expression, stable or transient.
    • Hygromycin resistance gene for selection of stable cell lines.
     
    pCMV3-C-Myc-NCV (Negative Control Vector) Physical Map
     
    Vector Sequence
    Download     
     
    Description
     
     Vector Name pCMV3-C-Myc-NCV
     Vector Size

    6019bp

     Vector Type Mammalian Expression Vector
     Expression Method Constitutive, Stable / Transient
     Promoter CMV
     Antibiotic Resistance Kanamycin
     Selection In Mammalian Cells Hygromycin
     Protein Tag Myc
     Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)
     
    Schematic of pCMV3-C-Myc-NCV (Negative Control Vector) Multiple Cloning Sites

    Size / Price
    Catalogue : CV014
    Prix catalogue : 
    Prix :      (You Save: )
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »