pCMV3-N-HA (Suitable for intracellular protein expession)

pCMV3-N-HA Physical Map
Download sequence
pCMV3-N-HA Physical Map

Comments for pCMV3-N-HA:

  • • CMV promoter: bases 250-837
  • • Enhancer: bases 838-1445
  • • SV40 early promoter: bases 2342-2711
  • • Hygromycin ORF: bases 2729-3754
  • • pUC origin: bases 4397-5070
  • • Kanamycin ORF: bases 5144-5959

Cloning Sites for ORF Inserting

Cloning Sites for ORF Inserting

Expression Vector pCMV3-N-HA Information Description

Vector Name pCMV3-N-HA
Vector Size 6101bp
Vector Type Mammalian Expression Vector
Expression Method Constitutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward: T7(TAATACGACTCACTATAGGG); Reverse: BGH(TAGAAGGCACAGTCGAGG)

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3'. The amino acid sequence is: YPYDVPDYA.

Mammalian Expression Vectors

More Reagents and Services