EHD2 cDNA ORF Clone, Rat, C-Myc tag

Price:
Size:
Number:

EHD2 cDNA ORF Clone, Rat, C-Myc tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1632 bp
Description
Full length Clone DNA of Rat EH-domain containing 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

EHD2 Background Information

The four mammalian C-terminal Eps15 homology domain-containing proteins (EHD1-EHD4) play pivotal roles in endocytic membrane trafficking. C-Terminal EH domain-containing protein 2 (EHD2) of the EHD family is associated with plasma membrane. which initial description as a plasma membrane-associated protein. EHD2 is important for protein interactions during vesicular trafficking. EHD2 was linked with neuronal apoptosis and microglial phagocytosis. Eps15 homology domain-containing 2 (EHD2) is a tumor suppressor gene, overexpressed in several solid tumors, including ovarian cancer and esophageal squamous cell carcinoma, EHD2 may serve as a prognostic marker in breast cancer.
Full Name
EH-domain containing 2
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait