TCAIM cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

TCAIM cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
213 bp
Description
Full length Clone DNA of Human T cell activation inhibitor, mitochondrial
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Sequencing Primers
T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

More Information About TCAIM

Entrez Gene ID

TCAIM cDNA ORF Clone, Human, untagged: Alternative Names

C3orf23 cDNA ORF Clone, Human; TOAG-1 cDNA ORF Clone, Human; TOAG1 cDNA ORF Clone, Human

TCAIM Background Information

Full Name
T-cell activation inhibitor, mitochondrial
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait