TNFR2 / TNFRSF1B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

TNFR2 / TNFRSF1B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1386 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens tumor necrosis factor receptor superfamily, member 1B (TNFRSF1B).
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

TNFR2 / TNFRSF1B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Alternative Names

CD120b cDNA ORF Clone, Human; p75 cDNA ORF Clone, Human; p75TNFR cDNA ORF Clone, Human; TBPII cDNA ORF Clone, Human; TNF-R-II cDNA ORF Clone, Human; TNF-R75 cDNA ORF Clone, Human; TNFBR cDNA ORF Clone, Human; TNFR1B cDNA ORF Clone, Human; TNFR2 cDNA ORF Clone, Human; TNFR80 cDNA ORF Clone, Human

TNFR2 / TNFRSF1B Background Information

Tumor necrosis factor receptor superfamily, member 1B (TNFRSF1B), also known as Tumor necrosis factor receptor 2 (TNFR2) or CD12b antigen, is a member of the tumor necrosis factor receptor superfamily. TNFR2/CD12b/TNFRSF1B is a member of the TNF-receptor superfamily. This protein and TNF-receptor 1 form a heterocomplex that mediates the recruitment of two anti-apoptotic proteins, c-IAP1 and c-IAP2, which possess E3 ubiquitin ligase activity. Knockout studies in mice also suggest a role of this protein in protecting neurons from apoptosis by stimulating antioxidative pathways. TNFR2/CD12b/TNFRSF1B is not a major contributing factor to the genetic risk of type 2 diabetes, its associated peripheral neuropathy and hypertension and related metabolic traits in North Indians. Tumor necrosis factor receptor superfamily, member 1B (TNFRSF1B) has been reported to be associated with SLE risk in Japanese populations. TNFR2/CD12b/TNFRSF1B serves as a receptor with high affinity for TNFSF2 and approximately 5-fold lower affinity for homotrimeric TNFSF1. This receptor mediates most of the metabolic effects of TNF-alpha. Isoform 2 blocks TNF-alpha-induced apoptosis, which suggests that it regulates TNF-alpha function by antagonizing its biological activity.
Full Name
tumor necrosis factor receptor superfamily, member 1b
References
  • Komata T, et al. (1999) Association of tumor necrosis factor receptor 2 (TNFR2) polymorphism with susceptibility to systemic lupus erythematosus. Tissue Antigens. 53(6): 527-33.
  • Tsuchiya N, et al. (2001) Analysis of the association of HLA-DRB1, TNFalpha promoter and TNFR2 (TNFRSF1B) polymorphisms with SLE using transmission disequilibrium test. Genes Immun. 2(6): 317-22.
  • Guo G, et al. (1999) Role of TNFR1 and TNFR2 receptors in tubulointerstitial fibrosis of obstructive nephropathy. Am J Physiol. 277(5): 766-72.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait